1)Department of Human Genetics and Public Health,
Graduate School of Proteomics, Faculty of Medicine, The
University of Tokushima, Tokushima, Japan;2)Department
of Urology, St. Marianna Medical University School of Medicine,
Kanagawa, Japan;and 3)Core Research for Evolutional
Science and Technology (CREST), Saitama, Japan
Abstract: Sex differentiation consists of multi-step pathway
that involves expression of many different genes. Müllerian
duct inhibitory substance (MIS) has a key role for regression
of the Müllerian duct during male sex differentiation. Recently,
endocrine disruptors (EDs), which often have estrogen-like
activities, have caused concern over worldwide. It has been
reported that estrogen regulates the MIS expression. Therefore,
we tested whether ERαand ERβinfluence the MIS
promoter activity in the NT2 / D1 cell line which expresses
many sex differentiation-related genes such as SRY, SOX9,
and DAX-1. RT-PCR analysis revealed that the NT2 / D1 cells
express both ERα and ERβ in addition to MIS.
Under the low concentration of 17β- estradiol (E2),the
over-expression of exogenous ERα increased the MIS
promoter activity 3.3-fold compared with the control. However,
as E2 concentration was increased, the MIS promoter activity
was decreased. For ERβ, we could not observe alterations
of the MIS promoter activity. Furthermore, the over-expression
of the exogenous SF-1 inhibited the activation of the MIS
promoter with ERα. Although it remains unclear whether
the effects of ERα on the MIS promoter are mediated
through the genomic or the no-genomic actions, the present
results suggest that ERα up-regulates the MIS promoter
activity in the NT2 / D1 cells under low concentrations
of E2, and that the two ERs may work in different manners
for the MIS promoter activation. The present findings may
be useful to understand the molecular mechanisms by which
EDs or estrogens affect the MIS expression. J. Med. Invest.
50 : 192-198, 2003
Keywords:sex differentiation, MIS, promoter, estrogen, estrogen
receptor
INTRODUCTION
Sex differentiation is an elaborated cascade which requires
participation of many different genes (1-3). In male differentiation,
indifferent gonad (bipotent gonad) is differentiated into
fetal testis after the expression of SRY (sex-determining
region on Y). During sex differentiation for males, Müllerian
inhibitory substance (MIS) is expressed by Sertoli cells
of fetal testis and induces regression of the Müllerian
duct that forms the anlagen of the uterus, oviducts, and
upper part of the vagina (4). For sex differentiation for
females, MIS is not produced by the ovaries during fetal
development (5). However, it is produced by granulosa cells
of developing follicles in postnatal ovaries (5).
Recent studies have revealed that the MIS expression is
regulated by several transcription factors (6 -9). In fetal
Sertoli cells, SF-1up -regulates the expression of MIS through
its binding to the two binding sites within the proximal
MIS promoter (6). Situated there are the binding sites of
SOX9 and GATA4, which are presumed to have important roles
for male sex-differentiation, within the proximal MIS promoter
(6). SOX9 and GATA4 activate the MIS gene expression through
their binding to the MIS promoter and synergistic interaction
with SF-1 (6 - 9). WT-1also activates MIS gene by interaction
with SF-1, while DAX-1inhibits the MIS expression by interaction
with SF-1 (9, 10).
In the last few years, growing attention has focused on
estrogen-like activity exerted by the endocrine disruptors
(EDs), which includes pharmacological compounds, pesticides
and industrial by-products whose environmental levels have
been suggested to increase health risks (11). Some of these
compounds can bind to ERs as either agonist or antagonists
of the steroid hormone (12). Estrogens are known to be important
for the development and the function of the reproductive
system (13, 14). It is possible that estrogen-mimics perturb
the function of the reproductive system. For example, the
clinical use of diethylstilbestrol (DES) by pregnant women
has resulted in the presence of the M¨ullerian duct remnants
of in live fetus (15). The prenatal exposure to diethylstilbestrol
delayed the onset of Müllerian duct formation in fetal male
mice (16). The expression of MIS was up -regulated in the
female mice without both estrogen receptor α and β,
suggesting that estrogen inhibits the expression of MIS
(17). However, it was also reported that the expression
of MIS was up -regulated by estrogen (16). Therefore, we
set out to determine what has on estrogen affects the MIS
promoter activity.
Here, we show that ER α and ER β have different
effects on the MIS promoter activity in the NT2/D1cells,
which was derived from a human testicular embryonal cell
carcinoma. Furthermore, we also show that the ERα-E
2 complex repressed the MIS promoter activity mediated with
SF-1in those cells.
MATERIALS AND METHODS
Preparation of the human MIS promoter-firefly luciferase
reporter construct
Human MIS promoter a 273 bp fragment was amplified using
a PCR technique using normal male genomic DNA as a template
(upstream primer : 5'- CTCGAGGGACAGAAAGGGCTCTTTGA-3'. downstream
primer :5'-AGATCTCGTGGGTGCTGCCAGGGGCT-3'), and was cloned
into pGL3-basic using Bgl ?and Xho?sites. ERα-pSG5
and SF-1-pBluescript, which were used for over- expression
of ERα and SF-1, were from Dr. Jean-Marc. Vanacker
(Lyon, Cedex, France). To insert into the pCXN2 vector,
SF-1cDNA was modified with a PCR technique using SF-1-pBluescript
as a template. pCXN2 empty vector was obtained from Dr.
Miyazaki (Osaka, Japan)(18). Authenticity of all constructs
was confirmed by sequencing. Those constructs were shown
to work well in the NT2/D1 cells with RT-PCR analysis.
Transfection of plasmid DNA and dual luciferase assay
The NT2/D1cells and the human fetal fibroblast cells (ATCC)
were cultured in Dulbecco's modified Eagle's medium (DMEM),
which contained no phenol red and was supplemented with
10% fetal calf serum, penicillin-streptomycin at 37°C
in a 5% CO2. then, 100 ng MIS -273-pGL3 basic reporter plasmid,
10 ng pRL-TK Renilla luciferase plasmid and 50 ng of ERα-pSG5
or/and 50 ng of SF-1-pCXN2 were co -transfected into the
cells using FuGENE 6 transfection reagent (Roche) according
to the manufacturer's method. Dual luciferase assay was
performed by at least three separate transfections in triplicate
using picha gene dual luciferase Assay Kit (Toyo Ink) according
to the manufacturer's instructions.
RT-PCR
Total RNA from the NT2/D1 cells were isolated by TRIzol
Reagent (invitrogen) according to the manufacturer's method.
Then 2.5 µg of the total RNA was subjected to reverse
transcription. The condition for PCR was as follows:initial
denaturation at 94°C for 30 secs, annealing at 55°C
(ERα, ERβ) or 63°C (MTS) for30 secs and extension
at 72°C for 1min. The PCR was carried out in 35 cycles.
The final extension step was at 72°C for 10 min. The
reaction mixture consisted of 2.0 µl of cDNA, 10×PCR
buffer, 0.8mM dNTPs, primers and 0.5 units of Taq polymerase
in a total volume of 20 µl. The PCR products were
loaded on 2.5% agarose gel with 1×TBE as buffer and
were visualized with ethidium bromide staining. The primers
used for MIS were as follows:the forward primer:5'-GCAACACCGGTGACAGGCAG
-3', and the reverse primer :5'-CAGCCCTCGTCACAGTGACC-3'.
The primers used for ERα were as follows:the forward
primer:5'-ACTGTGCAGTGTGCAATGAC-3', and the reverse primer
: 5'- CATCATCTCTCTGGCGCTTG -3'. The primers used for ERβ
were as follows:the forward primer:5'-ATCGCTAGAACACACCTTAC-3',
and the reverse primer : 5'- CACTTCGTAACACTTCCGAA -3'. All
primer sets for amplification of cDNA were generated to
encompass at least one intron in each gene.
RESULTS
NT2/D1 cell line expresses ERα and ERβ
Some studies reported that the NT2/D1cell line expresses
the genes participating in sex- determination or sex-differentiation
such as SRY, SOX9 and DAX-1(6,19). To elucidate whether
MIS is expressed in this cell line, we carried out RT-PCR
analysis using a MIS-specific primer set. As a result, we
found that MIS was expressed at a low level in the NT2/D1
cell line (Fig.1a). Therefore, we used this cell line for
molecular analysis for effects of estrogen on the MIS expression.
When we tested whether ERα and ERβ are expressed
in the NT2/D1 cell line using RT-PCR, we found that both
genes were expressed in this cell line (Fig.1b, 1c).
To clarify whether estrogen has some effects on the expression
of MIS, we carried out dual luciferase reporter assay to
assess the MIS promoter activity under different concentrations
of β - estradiol (E2). It was reported that a 273 bp
DNA fragment upstream from the translation initiation codon
of the MIS was important for MIS expression (6). This fragment
contains a SOX9 binding site and two SF-1binding sites,
and those transcription factors were suggested important
for MIS expression (6). Therefore, we generated a firefly
luciferase reporter construct that possesses the 273bp DNA
fragment of the MIS promoter, designed as pGL3 -MIS 273,
according to a previous study (6). The sequence of the human
proximal MIS promoter is shown in Fig.2.
When we cultured the NT2/D1 cells using the medium containing
the fetal calf serum stripped for lipid-soluble hormones,
those cells could not growth. Therefore, in the present
study, we cultured cells in the medium that was not stripped
for lipid-soluble hormones. The concentration of E2 in the
fetal calf serum was approx-imately 22.84 pg/ml(0.08 nM),
according to the certificate of product.
When the amount of E2 in the culture medium was increased,
no apparent dose - dependent effects of E2on the MIS promoter
was observed (Fig. 3). However, we could not rule out the
possibility that the amount of ERs expressed in the NT2/D1
cells was inadequate to exhibit their functions. Semi-quantitative
RT-PCR analysis of the two ERs under the different concentrations
of E2 could not reveal significant alterations of expression
of both ERs (data not shown).
Over-expression of ERα increases the MIS promoter
activity
To over-express ERα or ERβ in the NT2/D1cells,
ERα-pSG5 and ERβ -pCXN2 were transfected into
the NT2/D1 cells. When ERα or ERβ were over-
expressed in the NT2/D1cells under several concentrations
of E2, the two ERs were completely different in the dose
-responsiveness to E2 for the MIS promoter activity (Figs.
4, 5).
For ERα, the MIS promoter activity was increased3.3-fold
compared with the controls under no additional E2 to the
medium (Fig.4). As the E2 concentration was increased, the
MIS promoter activity was decreased (Fig. 4). When E2 was
added in the medium up to final concentrations of 10 nM,
the activity of MIS proximal promoter became almost one-third
compared with no additional E2 (Fig.4). To confirm that
ERα has transcriptional activity in the NT2/D1 cells,
the reporter construct, which contains a firefly luciferase
gene ligated with a thymidine kinase minimum promoter and
estrogen responsive element (ERE), was co -transfected into
the NT2/D1cells with the ERα over- expression vector.
As a result, the reporter gene activity was increased according
to the concentrations of E2, suggesting that the exogenous
ERα can work in the NT2/D1 cells (data not shown).
In contrast to ERα, for ERβ, the response of
the MIS promoter to E2, which was observed for ERα,
was not detected, and the promoter activity was similar
to the controls, suggesting that the type of ERs is crucial
for regulation of the MIS promoter activity (Fig.5).ERα
affects SF-1-dependent MIS proximal promoter activity
When SF-1and ERα were simultaneously over-expressed
in the NT2/D1 cells, it became clear that the MIS promoter
activity was similar to that observed for SF-1alone which
increased the promoter activity by 2.5 -fold compared with
the control (Fig.6). This result suggested that SF-1inhibits
the MIS promoter activity mediated with ERα (Fig.6).
Furthermore, the MIS promoter activity mediated with SF-1was
repressed in a E2 dose-dependent manner (Fig.6).
DISCUSSION
One of major targets for EDs is thought to be a sex differentiation
system during fetal stage (11). MIS has important roles
for regression of the Müllerian duct during male sex differentiation
(1- 4). Therefore, we addressed whether E2 affects the MIS
expression in the promoter level using the NT2/D1 cells
as a model of the pre-mature Sertoli cell.
ERs are known to be different in their tissue distributions
and presumed functions (20). In the present study, over-expression
of two ERs in the NT2/D1 cells demonstrated that ERα
but not ERβ up-regulated the MIS promoter activity.
Furthermore, we showed that the MIS promoter activity mediated
with ERα was repressed in an E2 dose-dependent
manner.
It was reported that DES - exposed fetus exhibits a delay
in the formation and regression of the Müllerian duct (15,
16). Therefore, it may be possible that one of the effects
of E2 on the sex differentiation may be to change the timing
of the initiation for formation and regression of the Müllerian
duct (16).
It was reported that SF-1is expressed in the fetal Sertoli
cells and has important roles for expression of MIS (6 -
9, 21). The present results suggested that the MIS expression
mediated with SF-1may be influenced by E2 through ERα.
However, in the fragment of the MIS promoter used in the
present study, which contained a 273 bp region upstream
from the translation start codon of the MIS gene, there
is no complete estrogen receptor response element (6). However,
there are two SF-1 binding sites that contain ERE half-site
like motives and four sequences similar to ERE half-sites
(Fig.2). For examples, Jena-Marc Vanacker et al reported
that ERα but not ERβ binds to SF-1 response
elements and activates the osteopontin gene promoter (22).
Indeed, since there are two SF-1 response elements, which
contain similar sequences with half motives of ERE, in the
MIS-273bp promoter, ERα may bind to them.
There are some studies that reported that ligand-free and
ligand-bound nuclear receptors have different functions
for the transcription of their target genes (23, 24). The
findings of present study suggested that ERα up-regulated
transcriptional activity of the human MIS promoter under
low concentrations of E2, and that it was decreased as the
concentration of E2 was increased. Although we could not
remove estrogens completely because the NT2/D1 could not
survive without lipid-soluble hormones, it is possible that
ligand-unbound ERα up-regulated transcriptional
activity of the human MIS promoter.
For ERβ, Shapiro et al. has reported that E2-unbound
ERβ induced the high constitutive activity of 5.5kb
rat vasopressin promoter and that the E2-bound ERβ
inhibited the high constitutive activity (25). They reported
that the constitutive activity of ERβ may be due
to transcription from an AP1-like sequence, which was not
found in the MIS promoter region analyzed in the present
study (25). In present study, over- expression of ERβ
did not show the response of the MIS promoter to E2, which
was observed for ERα.
Some hypotheses appear to explain that SF-1antagonizes the
effect of ERα on the MIS promoter. First, the
SF1-response elements may be important for both ERα
to bind to the human MIS promoter, and SF-1may compete with
ERα for its binding sites (22). Second, since
ERα can physically interact with SF-1 (26), this
interaction may lead to block access of ERα to
the MIS promoter.
In the present study, when SF-1and ERα were simultaneously
over-expressed in the NT2/D1 cells, the MIS promoter activity
was decreased as the E2 concentration was increased. Liganded
ERα may be different from the un-liganded one
in the interaction with SF-1or the affinity to the MIS promoter.
We may also have to pay attention to the possibility that
ERα exhibits non-genomic functions in a ERE-independent
manner to affect the functions of SF-1 (27, 28). To test
these hypotheses, future studies are required.
In conclusion, although it remains unclear whether the effects
of ERα on the MIS promoter are mediated through
the genomic or non-genomic actions, the present results
may suggest that ERα up-regulates the MIS promoter
activity under low concentrations of E2 and that it inhibits
the effects of SF-1 on the MIS promoter. The present findings
may be useful to understand the molecular mechanisms by
which EDs or DES affects the MIS expression.
ACKNOWLEDGMENT
We are grateful to Miss Unemi and Miss Tsuji, University
of Tokushima for technical assistance. Our study was supported
in part by grants from Core Research for Evolutional Science
and Technology (CREST) and the Ministry of Health, Labour
and Welfare.
REFFERENCES
1.Koopman P, Bullejos M, Bowles J:Regulation of male sexual
development by Sry and Sox9.J Exp Zool 290:463 -74, 2001
2.Cotinot C, Pailhoux E, Jaubert F, Fellous M: Molecular
genetics of sex determination. Semin Reprod Med20:157-68,
2002
3.Veitia RA, Salas - Cortes L, Ottolenghi C, Pailhoux E,
Cotinot C, Fellous M:Testis determination in mammals: more
questions than answers. Mol Cell Endocrinol179:3 -16, 2001
4.Lee MM, Donahoe PK.:Müllerian inhibiting substance:a gonadal
hormone with multiple functions. Endocr Rev14:152- 64, 1993
5.Hirobe S, He WW, Lee MM, Donahoe PK : Müllerian inhibiting
substance messenger ribonucleic acid expression in granulosa
and Sertoli cells coincides with their mitotic activity.
Endocrinology131:854-62, 1992
6.De Santa Barbara P, Bonneaud N, Boizet B, Desclozeaux
M, Moniot B, Sudbeck P, Scherer G, Poulat F, Berta P:Direct
interaction of SRY-related protein SOX9 and steroidogenic
factor 1regulates transcription of the human anti - Müllerian
hormone gene. Mol Cell Biol18:6653 - 65, 1998
7.Watanabe K, Clarke TR, Lane AH, Wang X, Donahoe PK : Endogenous
expression of Müllerian inhibiting substance in early postnatal
rat sertoli cells requires multiple steroidogenic factor-1
and GATA-4-binding sites. Proc Natl Acad Sci USA 97:1624
-9, 2000
8.Tremblay JJ, Viger RS : Transcription factor GATA-4 enhances
Müllerian inhibiting SF-1. Mol Endocrinol13:1388 - 401,
1999
9.Tremblay JJ, Viger RS : Nuclear receptor Dax-1represses
the transcriptional cooperation between GATA-4and SF-1in
Sertoli cells. Biol Reprod 64:1191-9, 2001
10.Nachtigal MW, Hirokawa Y, Enyeart-VanHouten DL, Flanagan
JN, Hammer GD, Ingraham HA. Wilms' tumor1and Dax-1modulate
the orphan nuclear receptor SF-1in sex-specific gene expression.
Cell93:445 - 54, 1998
11.Mori C : Possible effects of endocrine disruptors on
male reproductive function. Kaibogaku Zasshi, 76 (in Japanese):361-
8, 2001
12.Sonnenschein C, Soto AM:An updated review of environmental
estrogen and androgen mimics and antagonists. J Steroid
Biochem Mol Biol65:143-50, 1998
13.Simpson ER : Genetic mutations resulting in loss of aromatase
activity in humans and mice. J Soc Gynecol Invest7 (Suppl.1):S18-21,
2000
14.Eddy EM, Washburn TF, Bunch DO, Goulding EH, Gladen BC,
Lubahn DB, Korach KS : Targeted disruption of the estrogen
receptor gene in male mice causes alteration of spermatogenesis
and infertility. Endocrinology137:4796 - 805, 1996
15.Gill WB, Schumacher GF, Bibbo M : Structural and functional
abnormalities in the sex organ of male offspring of mothers
treated with diethylstilbestrol(DES). J Reprod Med16:147-153,
1976
16.Visser JA, McLuskey A, Verhoef -Post M, Kramer P, Grootegoed
JA, Themmen AP: Effect of prenatal exposure to diethylstilbestrol
on Müllerian duct development in fetal male mice. Endocrinology,
139:4244 -51, 1998
17.Couse JF, Hewitt SC, Bunch DO, Sar M, Walker VR, Davis
BJ, Korach KS: Postnatal sex reversal of the ovaries in
mice lacking estrogen receptors alpha and beta. Science286:2328
-31, 1999
18.Miyazaki J, Takaki S, Araki K, Tashiro F, Tominaga A,
Takatsu K, Yamamura K. Expression vector system based on
the chicken beta -actin promoter directs efficient production
of interleukin-5.Gene15:269 -77, 1989
19.Clepet C, Schafer AJ, Sinclair AH, Palmer MS, Lovell-Badge
R, Goodfellow PN : The human SRY transcript. Hum Mol Genet2:2007-12,
1993
20.Denger S, Reid G, Brand H, Kos M, Gannon F: Tissue-specific
expression of human ERalpha and ERbeta in the male. Mol
Cell Endocrinol178:155-60, 2001
21.Hatano O, Takayama K, Imai T, Waterman MR, Takakusu A,
Omura T, Morohashi K : Sex- dependent expression of a transcription
factor, Ad4 BP, regulating steroidogenic P- 450 genes in
the gonads during prenatal and postnatal rat development.
Developmen120:2787-97,1994
22.Vanacker JM, Pettersson K, Gustafsson JA, Laudet V:Transcriptional
targets shared by estrogen receptor-related receptors (ERRs)
and estrogen receptor (ER) alpha, but not by ERbeta. EMBO
J18:4270 -9, 1999
23.Weston AD, Blumberg B, Underhill TM : Active repression
by unliganded retinoid receptors in development:less is
sometimes more. J Cell Biol161:223 - 8, 2003
24.Apriletti JW, Ribeiro RC, Wagner RL, Feng W, Webb P,
Kushner PJ, West BL, Nilsson S, Scanlan TS, Fletterick RJ,
Baxter JD:Molecular and structural biology of thyroid hormone
receptors. Clin Exp Pharmacol Physiol Suppl 25:S2-11, 1998
25.Shapiro RA, Xu C, Dorsa DM : Differential transcriptional
regulation of rat vasopressin gene expression by estrogen
receptor alpha and beta. Endocrinology141:4056 - 64, 2000
26.Drean YL, Liu D, Wong AO, Xiong F, Hew CL:Steroidogenic
factor 1 and estradiol receptor act in synergism to regulate
the expression of the salmon gonadotropin?beta subunit gene.
Mol Endocrinol10:217-29, 1996
27.Coleman KM, Smith CL : Intracellular signaling pathways:nongenomic
actions of estrogens and ligand-independent activation of
estrogen receptors. Front Biosci6:1379 - 91, 2001
28.Moggs JG, Orphanides G:Estrogen receptors:orchestrators
of pleiotropic cellular responses. EMBO Rep2:775 - 81, 2001
|
